Issue
Knowl. Manag. Aquat. Ecosyst.
Number 425, 2024
Multidisciplinary solutions for conservation
Article Number 17
Number of page(s) 9
DOI https://doi.org/10.1051/kmae/2024011
Published online 11 October 2024

© C. Condachou et al., Published by EDP Sciences 2024

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License CC-BY-ND (https://creativecommons.org/licenses/by-nd/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. If you remix, transform, or build upon the material, you may not distribute the modified material.

1 Introduction

One-quarter of the global freshwater fish diversity is found in the Neotropical region (Lévêque et al., 2008). Almost 2200 freshwater fish species are known from the Guiana Shield compared to less than 500 in Europe (Lemopoulos and Covain, 2019; Costa et al., 2021). Nevertheless, the Guiana Shield biodiversity is severely threatened by gold mining which induces deforestation, soil degradation, and a drastic decline in water quality (Cantera et al., 2022, 2023a, 2023b; Timsina et al., 2022). This is particularly worrisome as aquatic ecosystems provide pivotal ecosystem services to local human communities. For those human populations, protein intake largely relies upon river fish. The management of Guianese freshwater ecosystems is thus of primary importance for both biodiversity conservation and local human sustainability.

Recent technological advances in the field of genomics offer new tools for managers and practitioners to monitor entire fish assemblages using environmental DNA (eDNA) metabarcoding or to detect specific species or populations using targeted eDNA (Taberlet et al., 2018; Condachou et al., 2024). Nevertheless, the implementation of eDNA techniques in management and conservation plans relies on the availability of species genomics information. Indeed, building genomic reference databases is crucial for analysing eDNA samples and requires the sequencing of voucher specimens (Marques et al., 2021). Information about these voucher specimens must be properly referenced and the authenticity of each sequence must be checked by phylogenomic analysis (Botero-Castro et al., 2016). Until now due to the ease of access to the mitochondrial genome in comparison to the nuclear genome, most studies used mitochondrial information to build DNA reference databases. Using environmental DNA also implies designing universal or specific primers that can be optimized with such genomic species information. While many universal primers have been designed and evaluated for teleostean fishes (Valentini et al., 2016; Miya, Gotoh and Sado, 2020), specific primers allowing species-centered approaches are lacking for most species. For instance, complete genome sequences are available for no more than 2.4% of the 15 521 threatened species listed by the International Union for Conservation of Nature (IUCN) (Hogg et al., 2022). This situation also applies to freshwater fishes of French Guiana, with only 18 published mitochondrial genomes out of more than 400 species occurring in French Guiana (Sato et al., 2018).

The goal of the study was to provide mitochondrial genomic resources for the study of Myloplus rhomboidalis (locally called Koumarou), Hoplias aimara (Aimara) and Tometes trilobatus (Pakou). Those three large species are among the most researched species by local communities (Longin et al., 2021) and possibly suffer from overexploitation as population trends are decreasing (Allard et al., 2017). Moreover, T. trilobatus is strictly endemic to the Oyapock River (Le Bail et al., 2012) and is considered as Near Threatened by the IUCN (Allard et al., 2017). H. aimara, although widespread in French Guiana, locally suffers from overfishing for local subsistence and recreational angling, leading to the establishment of local regulations to lower fishing pressure (DEAL, 2017).

In this paper, we used a shotgun sequencing approach to obtain the complete mitochondrial genomes of the species, using multiple specimens from each species to take into account intra-specific variability. We then used these genomic resources to develop and test new digital PCR (dPCR) assays for each species, that could be used in future eDNA studies for species detection and monitoring of local populations.

2 Materials and methods

2.1 Target species

To provide genomic resources for designing Myloplus rhomboidalis, Hoplias aimara, and Tometes trilobatus target species assays, we sequenced the whole mitochondrial genomes of individuals of these three species (N = 9) and individuals from closely related species (N = 29) (Tab. 1). No specimen from closely related species was sequenced because T. lebaili is the only species from the Tometes genera in the Oyapock drainage basin.

Table 1

Species, voucher, locality information, collection date, GenBank accession number and coverage (average, minimum and maximum) of the analyzed specimens. Vouchers annotated as ‘*’ are stored in the CRBE biological collection and vouchers annotated as ‘**’ are stored in the MNHG. Coordinates of each collection site are indicated in Table S1.

2.2 Mitogenome sequencing and phylogenetic analysis

We used a genome-skimming approach as recently performed for other fish species (Murienne et al., 2016; Ory et al., 2019) which allows us to retrieve the high-copy fraction of the genome (e.g., organelle) using shallow shotgun sequencing. Total genomic DNA was extracted from muscle tissue using the DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA), following the manufacturer’s instructions. The quality and quantity of extracted genomic DNA was evaluated using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and a PicoGreen double-stranded DNA quantitation assay kit (Life Technologies, Carlsbad, CA, USA). Library construction was performed using the Illumina TruSeq Nano DNA Sample Prep Kit following the supplier’s instructions (Illumina Inc., San Diego, CA, USA). After shearing by ultrasonication with a Covaris M220 (Covaris Inc., Woburn, MA, USA), purified fragments were A-tailed and ligated to sequencing-indexed adapters. Fragments with an insert size of around 450 bp were selected with Agencourt Ampure XP beads (Beckman Coulter, Inc.), and enriched with 8 cycles of PCR before library quantification and validation. The pool of libraries was then hybridized on one lane of Hiseq 3000 or NovaSeq6000 flow cell using the Illumina TruSeq PE Cluster Kit v.3, and paired-end reads of 150 nucleotides were collected using the Illumina TruSeq SBS Kit v.3 (200 cycles). Sequence data were stored on the NG6 platform (Mariette et al., 2012). Quality filtering was performed by the Consensus Assessment of Sequence and Variation (CASAVA) pipeline.

The complete mitochondrial genomes were assembled de novo using NOVOplasty (Dierckxsens et al., 2017) and annotated using MitoAnnotator (Iwasaki et al., 2013). Phylogenetic analyses were performed separately for Serrassalmidae and Erythrinidae. Ribosomal genes were aligned using MAFFT v7 (Katoh and Standley, 2013) and the Iterative refinement method with local pairwise alignment information, with subsequent trimming using trimal 1.4 with the automated1 option. Coding genes were aligned using TranslatorX (Abascal, Zardoya and Telford, 2010) to consider the amino-acid sequence. Individual genes were concatenated using FasconcatG (Kück and Meusemann, 2010; Kück and Longo, 2014). We used a midpoint rooting approach. A Maximum Likelihood phylogenetic analysis was performed on all thirteen protein-coding genes and rRNA using RAxML-ng (Kozlov et al., 2019) and a GTR+G model was applied for each gene. ML tree search was based on ten random and ten parsimony starting trees. Nodal support was estimated using Transfer Bootstrap Expectation (Lemoine et al., 2018) using 1000 replicates and an automated stopping procedure.

2.3 Development of dPCR probes and primer for the three species of interest

We followed the framework put forward by the DNAqua-Net consortium and the MIQE guidelines to validate our targeted eDNA assays (Huggett, 2020; Thalinger et al., 2021).

2.3.1 Primer design and in silico validation

To implement our dPCR assay, we developed specific primers and probes for the three species of interest (M. rhomboidalis, T. trilobatus and H. aimara). Primers and probes were designed using primer3 software implemented in Geneious (Untergasser et al., 2007).

For the H. aimara, these assays targeted a 112 bp region of the nad5 gene, using the specific forward primer 5’- AATCGCAACATCCTTTACTG −3’, the specific reverse primer 5’- TACTGCAGGGGTATTTTCAT −3’ and the specific probe Cy5-AACCCCACGATTCCTGCCCC-QXL670. For M. rhomboidalis, a 125 bp fragment of the nad4 gene was targeted, using the specific forward primer 5’- CGGTGTTCACCTCTGAC −3’, the specific reverse primer 5’- GGTCAAGTATGACTATCATTCG −3’, and the specific probe ROX-CCGTAGCCGGTTCAATGGTCCTAGCTGC-QXL 610. For the T. trilobatus, a 127 bp fragment of the cox1 gene was targeted, using the specific forward primer 5’- CCAGCCATTTCACAATATCAA −3’, the specific reverse primer 5’- TGAGGTTTCGATCTGTAAGG −3’ and the specific probe TAMRA-CTCTCTGCCTGTTCTGGCTG CCGGA-BHQ2.

The specificity of the H. aimara primer and probes were tested in silico against all complete mitogenomes of the Erythrinidae family (N = 13). The dPCR design of T. trilobatus and M. rhomboidalis was tested against all complete mitogenomes of the Serrasalmidae family (N = 24). Then, the specificity of each primer and probes were checked against the NCBI database using blast (Altschul et al., 1990).

2.3.2 In vitro validation of dPCR

To test in vitro the specificity of each dPCR design, DNA was extracted from individuals of each species and their close relatives. Extraction was performed from muscle tissue using DNeasy Blood and Tissue kit (Qiagen, Valencia, CA, USA), following a protocol adapted from the manufacturer’s instructions. To test in vitro specificity of M. rhomboidalis, DNA was extracted from three Myloplus individuals: M. planquettei collected in French Guiana (Maroni river basin); M. rubripinnis (FL−15−071) sampled in French Guiana (Maroni river basin) and M. ternetzi (GEN163) sampled in French Guiana (Maroni river basin). Concerning T. trilobatus this specificity was tested with T. lebailli (GFSU14−141) collected in French Guiana (Maroni river basin). The specificity of H. aimara design was tested against four individuals of H. aimara collected in different French Guiana river basins (HYD15–1069, GEN4296, GEN3082, GEN2797). This design was also tested against other Erythrinidae species: H. malabaricus (GEN1380, GEN5538, GEN2521), Hoplerythrinus unitaeniatus (GEN5094) and Erythrinus erythrinus (MITA-15-0012).

2.3.3 dPCR assays

For each of the three in vitro specificity test, dPCR reaction mixtures were prepared in a pre-plate as follows. For Nanoplate 26K reactions (Qiagen, Cat.No/ID:250002), 10 μL of 4X QIAcuity Probe PCR kit (Qiagen, Cat.No/ID:250101), 1 μL of the 20X sets of primers and probes (M. rhomboidlais, H. aimara and T. trilobatus), 18 μL of eDNA and RNase-free water were combined to reach a final reaction volume of 40 μL.

Reaction mixtures were transferred into a QIAcuity Nanoplate and loaded onto the QIAcuity Eight instrument to perform dPCR. The amplification step was performed following this cycling protocol: 2 min at 95°C for enzyme activation, 15 s at 95°C for denaturation, and 30 s at 58°C for annealing/extension during 40 cycles. Then an imaging step was completed by reading the following channels: orange (excitation 543–565 nm; emission 580–606 nm) for T. trilobatus, crimson (excitation: 590–640 nm; emission 654–692) for H. aimara and red (excitation 570–596 nm; emission 611–653 nm) for M. rhomboidalis. Data were analyzed using the QIAcuity Software Suite V1.2 and expressed as copies/μL of reaction volume (40 μL final). Negative controls were displayed on each assay.

3 Results

3.1 Mitogenomes organisation

The mitochondrial genomes (Tab. 1) show the typical gene arrangement for vertebrates. As an example, we hereafter provide information about the mitogenome of Hoplias aimara (specimen GEN4296). The mean insert size at the library preparation step was 517 base pairs. After sequencing on one lane of an Illumina NovaSeq6000 along with other libraries, we obtained 4 142 388 paired reads. The circular mitochondrial genome was assembled based on 15 692 mitochondrial reads representing 0.21% of the total reads. All protein-coding genes started with an ATG codon except for the cytochrome c oxidase subunit I (cox1) genes which started with the GTG codon. Six TAA stop codons and one TAG stop codon were identified. Six incomplete stop codons were found (nad2, cox2, nad3, nad4, nad6, cob) adjacent to transfer RNAs encoded on the same strand.

3.2 Phylogeny of Erythrinidae

After concatenating the individual markers, our final supermatrix contained 14 047 sites with 2429 patterns distributed over 15 partitions. Our analysis stopped after 50 bootstrap replicates and yielded a Maximum Likelihood tree with a LogLikelihood of −47 792. The monophyly of genus Hoplias was highly supported with 100% bootstrap frequency [BF] (Fig. 1). H. intermedius was the sister group to H. malabaricus species (100% BF) and H. aimara sister to those two species. When several specimens from the same species were included, they all formed distinct monophyletic groups.

Thumbnail: Fig. 1 Refer to the following caption and surrounding text. Fig. 1

Maximum likelihood phylogeny of the Erythrinidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified nad5 fragments of the H. aimara target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference H. aimara sequence (GEN4296).

3.3 Phylogeny of Serrasalmidae

After concatenating the individual markers, our final supermatrix contained 14 102 sites with 4333 patterns distributed over 15 partitions. Our analysis stopped after 100 bootstrap replicates and yielded a Maximum Likelihood tree with a LogLikelihood of −80 952. Three distinct phylogenetic groups are depicted in Figure 2. They correspond to the subfamily Colossomatinae, and the Serrassalminae tribes Myleini and Serrasalmini (Fig. 2). Genera Myloplus and Tometes were not monophyletic. Acnodon oligacanthus was sister to Myloplus rhomboidalis (96% BF).

Thumbnail: Fig. 2 Refer to the following caption and surrounding text. Fig. 2

Maximum likelihood phylogeny of the Serrasalmidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified nad4 fragments of the M. rhomboidalis target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference M. rhomboidalis sequence (FL-15-148).

3.4 Specificity testing

Testing the H. aimara design against all mitogenomes from the Erythrinidae family revealed the specificity of the design with a high level of mismatch between H. aimara nad5 primers and probes regions and other Erythrinidae species (Fig. 1). One mismatch is present within the nad5 region of the different H. aimara species but not in the primer or probe binding site thus not affecting the design specificity. The dPCR test with H. aimara tissue showed DNA amplification of each of the 4 individuals of H. aimara tissue and no DNA amplification of any H. malabaricus, H. unitaeniatus or E. erythrinus tissue.

The in silico specificity testing of T. trilobatus design revealed no co-amplification of any species belonging to the Serrasalmidae family (Fig. 3). The in vitro test for T. trilobatus revealed the specificity of the design as no amplification of closely related species (T. lebaili) occurred.

Thumbnail: Fig. 3 Refer to the following caption and surrounding text. Fig. 3

Maximum likelihood phylogeny of the Serrasalmidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified cox1 fragments of the T. trilobatus target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference T. trilobatus sequence (OYA-Chi-12-12).

4 Discussion

This study provides new genomic resources for three commercially and culturally valuable fish species in French Guiana. Complete mitogenomes have been newly analysed for 16 species (26 specimens: 10 Erythrinidae and 16 Serrasalmidae). Phylogenomic analysis of the Serrasalmidae family showed a topology similar to the one obtained from the analysis of 2708 UCE (Ultra Conserved Elements) loci (Mateussi et al., 2020). The Colossomatinae subfamily is sister-group to the Serrasalminae subfamily which is subdivided into two distinct tribes (Myleini and Serrasalmini). Our phylogenomic analysis also supports previous findings on the non-monophyly of genus Myloplus and Tometes (Mateussi et al., 2020). The phylogenetic position of genus Acnodon has long been uncertain in the literature (Ortí et al., 2008; Mateussi et al., 2020; Kolmann et al., 2021). Based on our complete mitogenome analysis, the position of this genus in the phylogeny was consistent with the one proposed by (Mateussi et al., 2020) thus confirming genus Acnodon as a sister group to Myloplus rhomboidalis. It is interesting to notice that all those results are congruent between our study using complete mitochondrial genomes and previous studies based on nuclear UCEs (Mateussi et al., 2020), highlighting the robustness of both findings.

The phylogenomic analysis of the Erythrinidae family provides a first overview of the phylogenetic position of French Guiana species of Erythrinidae. The genus Hoplias was found to be monophyletic, with H. intermedius sister to H. malabaricus. The French Guiana specimens of Hoplias malabaricus present a high degree of divergence (92.7% identity) with the specimen sampled in Brazil (NC_057531). The mitogenome of AP011992 is nested well within the French Guiana lineage but no information about its origin was available.

Information provided by the complete mitogenome enabled the design of specific primers and probes. This study thus provides ready-to-use sets of probes and primers specific for three species of high interest in French Guiana. Alignments of the target region of each species showed a high species specificity of each assay while taking into account population-level variability. The M. rhomboidalis design provided in this study might be less efficient for populations originating from the Approuague River. Indeed, even a few mismatches (i.e., two) can alter the amplification efficiency of the set of primers and probe.

Targeted approaches are widely used corresponding to 68% of eDNA-based-fish studies (Yao et al., 2022). Yet, only 19% of those studies target species of economic interest (Yao et al., 2022). The three targeted species in this study are of high commercial and cultural value, providing food resources for several local communities. The development of such eDNA monitoring approaches should allow managers to perform a non-invasive follow-up of these fish populations. Indeed, dPCR procedures offer a fast and low-cost tool to evaluate species presence on large spatial scales (Condachou et al., 2024). Moreover, targeted approaches such as dPCR are promising tools for investigating fish abundance. In controlled environments, several studies found positive relationships between eDNA concentration and fish biomass (Takahara et al., 2012; Klymus et al., 2015; Benoit et al., 2023). Fernandez et al. (2023), showed a positive correlation between eels biomass estimated with electrofishing and eDNA concentration in Spanish Rivers. In freshwater of southern Australia, Rourke et al. (2024) also found a relationship between golden perch eDNA concentration and relative biomass estimated with electrofishing but not with relative abundance. Indeed, in natural environments, various biotic and abiotic factors affect the fate (production, degradation, transport) of eDNA in waters and thus alter the eDNA/biomass relationship (Yates, Fraser and Derry, 2019). Future studies should therefore explore the complex links between eDNA abundance in the water and targeted species biomass and abundance.

Supplementary Material

Table S1. Site coordinates. Access Supplementary Material

Acknowledgements

This work was supported by ‘Investissement d’Avenir’ grants managed by Agence Nationale de la Recherche (CEBA: ANR-10-LABX-25-01), ANR (DEBIT: ANR-17-CE02-007-01), DGTM and Office de l’Eau Guyane. This work is part of the CEBA-IQCN project.

Conflicts of interest

Laetitia Pigeyre is a research scientist at a private company specializing in the detection of environmental DNA by digital PCR.

Data availability statement

Genbank accession number for sequences will be available at the time of the publication. Vouchers are conserved and available in the biological collection of the CRBE (Toulouse 3 University) and at the Natural Museum of Geneva.

Author contribution statement

CC, JM, and SB conceived the ideas and design methodology; JM, SB, RV and RC, collected the data; LP and YC conducted the laboratory work; CC, JM and SB analyzed the data; CC, JM and SB led the writing of the manuscript. All authors contributed critically to the drafts and gave final approval for publication.

References

  • Abascal F, Zardoya R, Telford MJ. 2010. TranslatorX: multiple alignment of nucleotide sequences guided by amino acid translations. Nucleic Acids Res 38: W7–W13. [CrossRef] [PubMed] [Google Scholar]
  • Allard L, Brosse S, Covain R, Gozlan R, Bail P-YL, Melki F, Vigouroux R. 2017. Chapitres de la faune vertébrée de Guyane. 4. [Google Scholar]
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. J Mol Biol 215: 403–410. [CrossRef] [PubMed] [Google Scholar]
  • Benoit NP, Robinson KM, Kellogg CTE, Lemay MA, Hunt BPV. 2023. Using qPCR of environmental DNA (eDNA) to estimate the biomass of juvenile Pacific salmon (Oncorhynchus spp.). Environ DNA 5: 683–696. [CrossRef] [Google Scholar]
  • Botero-Castro F, Fidel, Delsuc F, Douzery EJP. 2016. Thrice better than once: quality control guidelines to validate new mitogenomes. Mitochondrial DNA Part A 27.1: 449–454. [CrossRef] [PubMed] [Google Scholar]
  • Cantera I, Coutant O, Jézéquel C, Decotte J-B, Dejean T, Iribar A, Vigouroux R, Valentini A, Murienne J, Brosse S. 2022. Low level of anthropization linked to harsh vertebrate biodiversity declines in Amazonia. Nat Commun 13: 3290. [CrossRef] [PubMed] [Google Scholar]
  • Cantera I, Jézéquel C, Dejean T, Murienne J, Vigouroux R, Valentini A, Brosse S. 2023a. Deforestation strengthens environmental filtering and competitive exclusion in Neotropical streams and rivers. Proc R Soc B Biol Sci 290: 20231130. [CrossRef] [PubMed] [Google Scholar]
  • Cantera I, Jézéquel C, Dejean T, Murienne J, Vigouroux R, Valentini A, Brosse S. 2023b. Functional responses to deforestation in fish communities inhabiting neotropical streams and rivers. Ecol Process 12: 52. [CrossRef] [Google Scholar]
  • Condachou C, Cuenot Y, Pigeyre L, Covain R, Brosse S, Murienne J. 2024. Monitoring the threatened Harttiella (Siluriformes, Loricariidae) with environmental DNA: A comparison between metabarcoding and targeted digital PCR. Aquat Conserv Mar Freshw Ecosyst 34: e4111. [Google Scholar]
  • Costa MJ, Duarte G, Segurado P, Branco P. 2021. Major threats to European freshwater fish species. Sci Total Environ 797: 149105. [CrossRef] [PubMed] [Google Scholar]
  • DEAL. 2017. Arrêté réglementant la pêche sur le plan d’eau du barrage de Petit Saut et ses abords. Recueil des actes administratifs. R03-2017-02-15–004. 4 pages. [Google Scholar]
  • Dierckxsens N, Mardulyn P, Smits G. 2017. NOVOPlasty: de novo assembly of organelle genomes from whole genome data. Nucleic Acids Res 45: e18. [Google Scholar]
  • Fernandez S, Gutiérrez Á, Deconinck D, Martinez JL, Alvarez A, Marquez I, Machado-Schiaffino G, Garcia-Vazquez E. 2023. Biomass quantification of the critically endangered European eel from running waters using environmental DNA. Fishes 8: 279. [CrossRef] [Google Scholar]
  • Hogg CJ, Ottewell K, Latch P, Rossetto M, Biggs J, Gilbert A, Richmond S, Belov K. 2022. Threatened Species Initiative: Empowering conservation action using genomic resources. Proc Natl Acad Sci 119: e2115643118. [CrossRef] [PubMed] [Google Scholar]
  • Huggett JF. 2020. The digital MIQE guidelines update: minimum information for publication of quantitative digital PCR experiments for 2020. Clin Chem 66: 1012–1029. [Google Scholar]
  • Iwasaki W, Fukunaga T, Isagozawa R, Yamada K, Maeda Y, Satoh TP, Sado T, Mabuchi K, Takeshima H, Miya M, Nishida M. 2013. MitoFish and MitoAnnotator: a mitochondrial genome database of fish with an accurate and automatic annotation pipeline. Mol Biol Evol 30: 2531–2540. [CrossRef] [PubMed] [Google Scholar]
  • Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30: 772–780. [CrossRef] [PubMed] [Google Scholar]
  • Klymus KE, Richter CA, Chapman DC, Paukert C. 2015. Quantification of eDNA shedding rates from invasive bighead carp Hypophthalmichthys nobilis and silver carp Hypophthalmichthys molitrix. Biol Conserv 183: 77–84. [CrossRef] [Google Scholar]
  • Kolmann MA, Hughes LC, Hernandez LP, Arcila D, Betancur-R R, Sabaj MH, López-Fernández H, Ortí G. 2021. Phylogenomics of piranhas and pacus (Serrasalmidae) uncovers how dietary convergence and parallelism obfuscate traditional morphological taxonomy. Syst Biol 70: 576–592. [CrossRef] [PubMed] [Google Scholar]
  • Kozlov AM, Darriba D, Flouri T, Morel B, Stamatakis A. 2019. RAxML-NG: a fast, scalable and user-friendly tool for maximum likelihood phylogenetic inference. Bioinformatics 35: 4453–4455. [CrossRef] [PubMed] [Google Scholar]
  • Kück P, Longo GC. 2014. FASconCAT-G: extensive functions for multiple sequence alignment preparations concerning phylogenetic studies. Front Zool 11: 81. [CrossRef] [PubMed] [Google Scholar]
  • Kück P, Meusemann K. 2010. FASconCAT: Convenient handling of data matrices. Mol Phylogenet Evol 56: 1115–1118. [CrossRef] [PubMed] [Google Scholar]
  • Le Bail P-Y., Fisch-Muller S, Vigouroux R, Keith P. 2012. Updated checklist of the freshwater and estuarine fishes of French Guiana. Cybium 36: 293–319. [Google Scholar]
  • Lemoine F, Domelevo Entfellner J-B, Wilkinson E, Correia D, Dávila Felipe M, De Oliveira T, Gascuel O. 2018. Renewing Felsenstein’s phylogenetic bootstrap in the era of big data. Nature 556: 452–456. [CrossRef] [PubMed] [Google Scholar]
  • Lemopoulos A, Covain R. 2019. Biogeography of the freshwater fishes of the Guianas using a partitioned parsimony analysis of endemicity with reappraisal of ecoregional boundaries. Cladistics 35: 106–124. [CrossRef] [PubMed] [Google Scholar]
  • Lévêque C, Oberdorff T, Paugy D, Stiassny MLJ, Tedesco PA. 2008. Global diversity of fish (Pisces) in freshwater. Hydrobiologia 595: 545–567. [CrossRef] [Google Scholar]
  • Longin G, Fontenelle G, Bonneau de Beaufort FL, Delord C, Launey S, Rinaldo R, Lassalle G, Le Bail P-Y, Roussel JM. 2021. When subsistence fishing meets conservation issues: Survey of a small fishery in a neotropical river with high biodiversity value. Fish Res 241: 105995. [CrossRef] [Google Scholar]
  • Mariette J, Escudié F, Allias N, Salin G, Noirot C, Thomas S, Klopp C. 2012. N G6: Integrated next generation sequencing storage and processing environment. BMC Genomics 13: 462. [CrossRef] [PubMed] [Google Scholar]
  • Marques V, Milhau T, Albouy C, Dejean T, Manel S, Mouillot D, Juhel J-B. 2021. GAPeDNA: Assessing and mapping global species gaps in genetic databases for eDNA metabarcoding. Divers Distrib 27: 1880–1892. [CrossRef] [Google Scholar]
  • Mateussi NTB, Melo BF, Ota RP, Roxo FF, Ochoa LE, Foresti F, Oliveira C. 2020. Phylogenomics of the Neotropical fish family Serrasalmidae with a novel intrafamilial classification (Teleostei: Characiformes). Mol Phylogenet Evol 153: 106945. [CrossRef] [PubMed] [Google Scholar]
  • Miya M, Gotoh RO, Sado T. 2020. MiFish metabarcoding: a high-throughput approach for simultaneous detection of multiple fish species from environmental DNA and other samples. Fish Sci 86: 939–970. [CrossRef] [Google Scholar]
  • Murienne J, Jeziorski C, Holota H, Coissac E, Blanchet S, Grenouillet G. 2016. PCR-free shotgun sequencing of the stone loach mitochondrial genome (Barbatula barbatula). Mitochondrial DNA Part A 27: 4211–4212. [CrossRef] [PubMed] [Google Scholar]
  • Ortí G, Sivasundar A, Dietz K, Jégu M. 2008. Phylogeny of the Serrasalmidae (Characiformes) based on mitochondrial DNA sequences. Genet Mol Biol 31: 343–351. [CrossRef] [Google Scholar]
  • Ory D, Cuenot Y, Vigouroux R, Covain R, Brosse S, Murienne J. 2019. Complete mitochondrial genome of the river stingray Potamotrygon orbignyi (Myliobatiformes: Potamotrygonidae). Mitochondrial DNA Part B 4: 3153–3154. [CrossRef] [Google Scholar]
  • Rourke ML, Broadhurst MK, Fowler AM, Hughes JM, DiBattista JD, Furlan EM. 2024. Correlated environmental DNA and electrofished estimates of relative biomass for golden perch, Macquaria ambigua. Front Fish Sci 2: 1358572. [CrossRef] [Google Scholar]
  • Sato Y, Miya M, Fukunaga T, Sado T, Iwasaki W. 2018. MitoFish and MiFish pipeline: a mitochondrial genome database of fish with an analysis pipeline for environmental DNA metabarcoding. Mol Biol Evol 35: 1553–1555. [CrossRef] [PubMed] [Google Scholar]
  • Taberlet P, Bonin A, Zinger L, Coissac E. 2018. Environmental DNA: for biodiversity research and monitoring. Oxford, Unit ed Kingdom: Oxford University Press, 272 p. [Google Scholar]
  • Takahara T, Minamoto T, Yamanaka H, Doi H, Kawabata Z. 2012. Estimation of fish biomass using environmental DNA. PLOS ONE 7: e35868. [CrossRef] [PubMed] [Google Scholar]
  • Thalinger B, Deiner K, Harper LR, Rees HC, Blackman RC, Sint D, Traugott M, Goldberg CS, Bruce K. 2021. A validation scale to determine the readiness of environmental DNA assays for routine species monitoring. Environ DNA 3: 823–836. [CrossRef] [Google Scholar]
  • Timsina S, Hardy NG, Woodbury DJ, Ashton MS, Cook-Patton SC, Pasternack R, Martin MP. 2022. Tropical surface gold mining: a review of ecological impacts and restoration strategies. Land Degrad Dev 33: 3661–3674. [CrossRef] [Google Scholar]
  • Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JAM. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35: W71–W74. [CrossRef] [PubMed] [Google Scholar]
  • Valentini A, Taberlet P, Miaud C, Civade R, Herder J, Thomsen PF, Bellemain E, Besnard A, Coissac E, Boyer F, Gaboriaud C, Jean P, Poulet N, Roset N, Copp GH, Geniez P, Pont D, Argillier C, Baudoin J-M, Peroux T, Crivelli AJ, Olivier A, Acqueberge M, Le Brun M, Møller PR, Willerslev E, Dejean T. 2016. Next-generation monitoring of aquatic biodiversity using environmental DNA metabarcoding. Mol Ecol 25: 929–942. [CrossRef] [MathSciNet] [PubMed] [Google Scholar]
  • Yao M, Zhang S, Lu Q, Chen X, Zhang S-Y., Kong Y, Zhao J. 2022. Fishing for fish environmental DNA: Ecological applications, methodological considerations, surveying designs, and ways forward. Mol Ecol 31: 5132–5164. [CrossRef] [PubMed] [Google Scholar]
  • Yates MC, Fraser DJ, Derry AM. 2019. Meta-analysis supports further refinement of eDNA for monitoring aquatic species-specific abundance in nature. Environ DNA 1: 5–13. [CrossRef] [Google Scholar]

Cite this article as: Condachou C, Cuenot Y, Pigeyre L, Covain R, Vigouroux R, Brosse S, Murienne J. 2024. Genomic resources for the monitoring and management of Tometes trilobatus, Hoplias aimara and Myloplus rhomboidalis, three exploited freshwater fish species in French Guiana. Knowl. Manag. Aquat. Ecosyst., 425, 17.

All Tables

Table 1

Species, voucher, locality information, collection date, GenBank accession number and coverage (average, minimum and maximum) of the analyzed specimens. Vouchers annotated as ‘*’ are stored in the CRBE biological collection and vouchers annotated as ‘**’ are stored in the MNHG. Coordinates of each collection site are indicated in Table S1.

All Figures

Thumbnail: Fig. 1 Refer to the following caption and surrounding text. Fig. 1

Maximum likelihood phylogeny of the Erythrinidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified nad5 fragments of the H. aimara target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference H. aimara sequence (GEN4296).

In the text
Thumbnail: Fig. 2 Refer to the following caption and surrounding text. Fig. 2

Maximum likelihood phylogeny of the Serrasalmidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified nad4 fragments of the M. rhomboidalis target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference M. rhomboidalis sequence (FL-15-148).

In the text
Thumbnail: Fig. 3 Refer to the following caption and surrounding text. Fig. 3

Maximum likelihood phylogeny of the Serrasalmidae family inferred from complete mitochondrial genomes using RAxML-NG. Bootstrap support frequencies are indicated on nodes. Amplified cox1 fragments of the T. trilobatus target assay are represented on the right. Highlighted nucleotides correspond to disagreement from the reference T. trilobatus sequence (OYA-Chi-12-12).

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.