EDP Sciences logo
Submit your paper
Search
Menu
All issues No 419 (2018) Knowl. Manag. Aquat. Ecosyst., 419 (2018) 25 Full HTML
Issue
Knowl. Manag. Aquat. Ecosyst.
Number 419, 2018
Topical issue on Crayfish
Article Number 25
Number of page(s) 11
DOI https://doi.org/10.1051/kmae/2018013
Published online 10 April 2018

© M. Boschetti et al., Published by EDP Sciences 2018

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License CC-BY-ND (http://creativecommons.org/licenses/by-nd/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. If you remix, transform, or build upon the material, you may not distribute the modified material.

1 Introduction

Crayfish are a very important component of freshwater habitats. Due to their role as detrital feeders and macrophyte grazers, they are pivotal to the population dynamics of both lentic and lotic waters, with their disappearance irremediably resulting in the alteration of the trophic net of a given ecosystem (Holdich and Reeve, 1991; Covich et al., 1999; Scalici and Gibertini, 2005). In the light of their biological characteristics and the level of protection warranted across the whole of Europe, some crayfish are considered as good umbrella and/or flagship species for freshwater communities (Füreder and Reynolds, 2003; Scalici and Gibertini, 2005).

In the Western Palearctic, three genera of native freshwater crayfish occur: genus Astacus Fabricius 1775, with three native species, genus Pontastacus Bott, 1950, with nine species, and genus Austropotamobius Skorikow, 1907 (Crandall and De Grave, 2017). The latter has recently undergone a deep taxonomic revision and, at the present-time, includes three species: A. torrentium (Schrank, 1803), stone crayfish, A. pallipes (Lereboullet, 1858) and A. italicus (Faxon, 1914), which are both referred to as white-clawed crayfish. Recently, based on a study carried out by Manganelli et al. (2006), Crandall and De Grave (2017) referred to Italian white-clawed crayfish as Austropotamobius fulcisianus fulcisianus (Ninni, 1886). Nevertheless, in the present paper, in agreement with Fratini et al. (2005) and Bernini et al. (2016), we decided to use the more widespread binomial name A. italicus, as it is in line with the taxonomy in use in the National Center for Biotechnology Information (NCBI) database and, as such, with the phylogenetic reconstructions we have herein provided.

The distribution range of the three Austropotamobius species encompasses the Italian Peninsula (Fratini et al., 2005; Trontelj et al., 2005; De Luise, 2006; Morpurgo et al., 2010; Kouba et al., 2014; Jelic et al., 2016), suggesting that Italy should be considered as a biodiversity hotspot for the genus (Baillie and Groombridge, 1996; Fratini et al., 2005). More in detail, four subspecies are comprised within A. italicus: A. i. carinthiacus, A. i. carsicus, A. i. italicus, and A. i. meridionalis (Fratini et al., 2005; Bernini et al., 2016). Furthermore, A. italicus and A. pallipes are included in the A. pallipes species-complex, which is classified as Endangered by the International Union for the Conservation of Nature and Natural Resources and has been included in the EU Habitats Directive Annexes II/V and in the Appendix III of the Convention of Bern (Füreder et al., 2010). Overall, in the last decades the A. pallipes species-complex populations have declined by 50–80% across Europe (Souty-Grosset and Reynolds, 2009). Major threats include occurrence of alien invasive crayfish species, spreading of diseases such as crayfish plague, poaching, overexploitation and habitat degradation (Füreder et al., 2010). Declines can also occur locally as a result of water pollution and changes in the hydrological regime of rivers due to anthropic use (Favilli and Manganelli, 2002; Legalle et al., 2008; Füreder et al., 2010).

Austropotamobius crayfish are generally considered sensitive to rapid environmental changes and water pollution. Despite their tolerance to broad variations of some parameters (Trouilhé et al., 2007), the species of the A. pallipes complex seem to prevalently find suitable environmental conditions in rivers included in the class I of EBI (Extended Biotic Index) (Scalici and Gibertini, 2005) and to require good physico-chemical quality water, especially concerning oxygenation and pH (Jay and Holdich, 1977; Jay and Holdich, 1981; Trouilhé et al., 2007; Beaune et al., 2018). On the contrary, A. torrentium tolerates a broader range of water conditions (Svobodová et al., 2012; Vlach et al., 2012), although it can be impaired by organic pollution (Pârvulescu et al., 2011). Nevertheless, Austropotamobius crayfish have been proposed as potential water quality bioindicators (Holdich and Reeve, 1991; Reynolds et al., 2002) and the species of the A. pallipes complex are specifically employed for monitoring lotic ecosystems (Scalici and Gibertini, 2005).

Recently, researchers focused on occurrence, distribution and taxonomy of A. pallipes and A. italicus subspecies in Italy. Austropotamobius pallipes inhabits the north-western part of the Peninsula, whereas A. italicus occurs across all the remaining regions (Chiesa et al., 2011), although it seems to be rarer in southern Italy and absent in Sicily and Sardinia (introduced stocks excluded: Aquiloni et al., 2010; Amouret et al., 2015). At the present-time, most studies refer to the Po River area (Trontelj et al., 2005; Zaccara et al., 2005; Ghia et al., 2006), part of the Apennines (Trontelj et al., 2005; Chiesa et al., 2011), close to the borders with Austria and Slovenia (Trontelj et al., 2005; Chiesa et al., 2011) and, to a much lesser extent, to Liguria and Tuscany (Bertocchi et al., 2008b; Chiesa et al., 2011). Regrettably, many remote or poorly accessible areas have scarcely been investigated, such as, for example, the Lunigiana. Hence, the distribution range of A. italicus across Italy is still debated.

Lunigiana is a scarcely populated region (980 km2) located in the northern part of Tuscany (Fig. 1), whose relatively intact natural ecosystems include a large part of the mountainous and hilly tributaries of the Magra River.

In the last decades, private companies have built more than 20 Run-of-River (RoR) mini-hydroelectric plants (Paish, 2002; Douglas, 2007) in the secondary and tertiary tributaries of the Magra River, with others potentially in planning for the next future (Autorità Bacino Magra, 2000). Although such plants are often considered as low-impact when compared to the traditional ones (Paish, 2002; Kaunda et al., 2012; Kern et al., 2012; Lazzaro et al., 2013; Gibeau et al., 2016), it must be noticed that they cause alteration to water flow, water quality, and habitat degradation in the diversion reach (Douglas, 2007; Kumar and Katoch, 2015; Kern et al., 2012; Lazzaro et al., 2013; Gibeau et al., 2016). Water removal for hydroelectric use and population isolation due to the presence of physical barriers in the streambed are generally considered to threaten the survival of both crayfish and aquatic invertebrates in general (Douglas, 2007; Pârvulescu and Zaharia, 2013; Stoch and Vigna Taglianti, 2014; Bologna et al., 2016). Nevertheless, the physical barriers might possibly contribute to hinder the diffusion of invasive crayfish species (Kerby et al., 2005; Frings et al., 2013; Manenti et al., 2014). Unfortunately, in the case of RoR plant construction, the lack of information on many protected species in the mountainous creeks of Lunigiana (crayfish included: Bertocchi et al., 2008a; Ciuffardi et al., 2009; Barbarotti et al., 2012; Dini, 2015; Cianfanelli et al., 2016) does not facilitate the implementation of good practice in land use and the enforcement of mitigation actions. Altogether, this seems to suggest that a deep investigation cannot be further delayed.

This study attempts to collect data on distribution and genetic identity of A. italicus in the upper part of the Magra River basin in Lunigiana and to highlight potential conservation issues of RoR plant installation. During this study, we also discovered and thus investigated the occurrence of branchiobdellidans in one of the detected crayfish populations.

thumbnail Fig. 1

Geographic context and map of the study area (Lunigiana, Tuscany, Italy). Nine transects were performed in eight streams. Red stars mark out the streams where we recorded white-clawed crayfish populations, while orange dots mark out surveyed streams where crayfish were not found. Modified from QGIS 2.14 open-source software (Quantum GIS Development Team, 2009).

2 Materials and methods

2.1 Study area

We selected eight secondary or tertiary tributaries of the Magra River, plus one site located in the upper part of the same watercourse (Tab. 1, Fig. 1). Streams were selected according to (in order of relevance): (i) preliminary surveys; (ii) location on both sides of the hydrographic basin; (iii) elevation above sea level; (iv) natural or partially modified streambed; (v) streambed accessibility.

Two streams, Civasola and Verdesina, were found to host white-clawed crayfish populations; hence, they are described here as focal areas of our study. Although both streams are located under the municipality of Pontremoli, they largely differ from each other for some environmental features (Tab. 1). The Civasola stream is a right tributary of the Magra River; it originates in the Tuscan-Emilian Apennines and after 7 Km merges into the Magra River at locality “Molinello”. Its water quality is classified as in a “good” ecological and chemical state (Autorità di Bacino del Fiume Arno, 2017a). Our transect was located between 663 m (start) and 722 m (end) a.s.l.

The Verdesina stream originates in the Tuscan-Emilian Apennines at Monte Borraccìa (1250 a.s.l.) and after 6 Km merges into the Verde stream, which is a right tributary to the Magra River in the town of Pontremoli. Its water quality is classified as in a “good ecological yet poor chemical state” (Autorità di Bacino del Fiume Arno, 2017b). Our transect started at 465 m a.s.l. and ended at 500 m a.s.l.

Table 1

Streams investigated in the present study, with municipality/locality, altitude on sea level of the starting point of each transect (Alt) and environmental features of the streams. Av height = average water height in the transect, during the sampling occasions. Av width = average width of the streambed within the transect. Av substratum = prevailing substratum in the riverbed, classified as megalithal (rocks and stones of >40 cm in diameter), macrolithal (stones between 20 and 40 cm in diameter), mesolithal (stones between 6 and 20 cm in diameter) and microlithal (small stones between 2 and 6 cm in diameter) (Buffagni and Erba, 2007). Riparian vegetation = presence of vegetation (trees and bushes) both autocthonous and allocthonous, along the banks of the stream. Streams hosting crayfish are highlighted in bold.

2.2 Data collection and morphological measurements

We carried out diurnal and nocturnal preliminary transects in all of the eight selected creeks, at least once a month, from May to September 2015 and from March to June 2016 (Tab. 1). We selected one transect per stream, with the length of each transect ranging between 200 and 500 m depending on riverbed accessibility. Due to logistic constraint, we assumed that the species was absent from a specific transect when we could not detect any exuvia nor living specimen after a minimum of two surveys.

For each transect, two operators walked counter-current on each side of the riverbed to geo-reference the occurrence of any crayfish or their remains (e.g., exuviae) using Garmin® GPS devices (Etrex 20x® and Etrex 30®). Whenever it was possible, potential shelters such as stones and underwater woods were flipped to check for hidden individuals. If many individuals were present in a small area (<5 m wide) such as side pools, they were geo-referenced as a single GPS point.

From June to September 2016, we only investigated Civasola and Verdesina streams, performing three additional nocturnal surveys per stream (one visit per month). As such, we performed a total of 5 surveys on Civasola stream and 11 on Verdesina stream. One pereiopod (non-lethal sample) selected at random for each manipulated crayfish was cut with blades, sterilised by 1-minute dipping in a 2.5% sodium hypochlorite solution, and then preserved in 96% ethanol before being stored at −32 °C for genetic analysis. We sampled 48 (21 males, 26 females, 1 undetermined) and 44 (22 males, 16 females, 6 undetermined) individuals in the Civasola and Verdesina, respectively. We measured (i) cephalothorax length (CL), from the rostral apex to the posterior median edge of the cephalothorax, to determine class age and sexual maturity of the individuals (Pratten, 1980; Scalici and Gibertini, 2009; Scalici and Gibertini, 2011; Ghia et al., 2015; Wendler et al., 2015), (ii) rostrum total length (RL) and (iii) length of the rostrum apex (AL) to calculate AL/RL ratio, in order to obtain a preliminary morphological identification of the species (Grandjean et al., 2000a; Bertocchi et al., 2008a; Bertocchi et al., 2008b; Chucholl et al., 2015). All parameters were measured to the nearest 0.1 mm using a slide calliper (Mitutoyo ® 530 series); the crayfish were then released at the catching site. Additionally, we collected and dry-preserved all visible exuviae to take the same biometric measurements also from intact carapaces.

Only crayfish found in the Verdesina stream hosted branchiobdellidans on cephalothorax, chelae and/or pereiopods. In the field, we visually estimated, but did not manually count, the density of ectosymbionts according to three different abundancy classes: low abundancy of ectosymbionts (no visible worms on crayfish surface), medium (approximately less than 20 worms per crayfish) or high (more than 20 worms per crayfish).

2.3 Statistical analysis on morphometric data

Analyses were performed with statistical software RStudio© Desktop 1.0.143 (RStudio Team, 2015). First, we checked for normal distribution and homoscedasticity of morphometric variables with graphical representations, Shapiro-Wilk test and Bartlett's test. Sex ratio was calculated from manipulated individuals as the proportion of males relative to females. Since data were normally distributed, two-way ANOVA was performed on AL/RL ratio/sex/stream relations and on CL/sex/stream relations, with subsequent Tukey's honest significance post-hoc test. Sex ratio among streams was tested with Pearson's Chi-squared test. Level of ectosymbiont occurrence between streams was tested with non-parametric Kruskal-Wallis rank sum test. Subsequently, we calculated Spearman rs and then performed one-way ANOVA on cephalothorax length/level of ectosymbiont occurrence relations, followed by Tukey's honest significance post-hoc test. Finally, ectosymbiont prevalence between sexes was tested with the non-parametric Kruskal-Wallis rank sum test. Given that the parasitized individuals with a CL > 45.0 mm were all males, we performed this test only on crayfish with a CL ranging between 25.0 and 45.0 mm, to include individuals of both sexes and comparable size.

2.4 DNA extraction, amplification and sequencing

Genomic DNA was extracted from six randomly selected pereiopods (Civasola, N = 3; Verdesina, N = 3). We used Gentra® Puregene® Core Kit-A (Qiagen, Germany) following the manufacturer's instructions. The reliability of each extraction was checked through multiple negative controls. DNA concentration and purity were assessed with an Eppendorf BioPhotometer (AG Eppendorf).

We amplified a 1,173 bp-long portion of the mitochondrial DNA (mtDNA) gene codifying for the subunit I of the Cytochrome Oxydase (COI) using primers FC_COI5'-F (5'-TTTGGCACTTGAGCTGGGATAG-3') and FC_COI3'-R (5'-GCATCTGGATAATCAGAATACC-3') (Bernini et al., 2016). PCRs were run in a MyCycler™ thermal cycler (Biorad, USA) with the following thermal profile: 3 min at 94 °C, 35 cycles of 1 min at 94 °C, 1 min at 55 °C and 1 min at 72 °C, followed by 7 min at 72 °C. Reactions (50 μl) were prepared with 1 μl of AmpliTaq Gold DNA Polymerase (1 U/μl, Thermo Fisher Scientific), 4 μl of 25 mM MgCl2 (Thermo Fisher Scientific), 5 μl of 10X PCR Gold buffer (Thermo Fisher Scientific), 5 μl of 2.5 mM dNTPs (Sigma Aldrich), 3 μl of each primer (1 μM) and 20 ng of DNA template. PCR products were purified (Genelute PCR Clean-up Kit, Sigma Aldrich) and directly sequenced on both DNA strands using internal primers (A.ital_COI_644Fw: 5'- CTTCATTTTTTGATCCYGCTGG −3' and A.ital_COI_898Rev: 5'- GTAGCAGAAGTAAAATATGCTCG −3'; GATC Biotech, Germany). We performed the alignment with Clustalx (v. 1.81: Thompson et al., 1997) using a 534 bp-long fragment (from pos. 118 to pos. 651 of A. pallipes NC026560; Grandjean et al., 2016; codon reading frame, 1) plus 114 GenBank sequences of Austropotamobius subspecies (Supplementary Table 1). Austropotamobius pallipes NC026560 was used as outgroup (Grandjean et al., 2016).

All sequences were deposited at the National Centre for Biotechnology Information (GenBank accession codes: MG244267- MG244272, Supplementary Table 1).

2.5 Mitochondrial DNA analyses

We used arlequin (v. 3.5.1: Excoffier and Lischer 2010) to infer haplotypes and check for neutral evolution of the mtDNA sequences (Tajima's D: Tajima, 1989). We used Smart Model Selection (SMS) (Lefort et al., 2017) as implemented in PhyML 3.0 (Guindon et al., 2010) and found that the HKY (Hasegawa et al., 1985) + G (α = 1.361) + I (=67.5%) was the best evolutionary model fitting to our crayfish dataset according to both the Akaike (AIC = 4,047.6) and Bayesian (BIC = 5,378.8) Information Criterion. In a Bayesian (BI) analysis, however, Metropolis-coupled Monte Carlo Markov Chains integrate over the uncertainty in parameter values. Hence, only the general form of the model was included in the BI performed with MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001). Two independent runs of analysis were conducted for 3 500 000 generations with a sample frequency of 100 (four chains, heating = 0.2, random starting tree). Convergence between runs was monitored through the Average Standard Deviation of Split Frequencies (ASDSF) until this value dropped well below 0.01. Stationarity was reached after 700 000 generations (ASDSF = 0.006414) as inferred using Tracer 1.5.0 (Rambaud and Drummond 2007). Hence, 14 000 trees were discarded as burn-in, and the remaining 56 002 trees were used to produce a 50% majority-rule consensus tree.

3 Results

3.1 Austropotamobius italicus

Two out of the eight investigated streams hosted white-clawed crayfish: Civasola and Verdesina (Tab. 1). In all the other streams, we did not record any living specimen nor any sign of presence (exuviae, burrows, etc.).

Sex ratio was males:females 0.81 (N = 47) and 1.38 (N = 38) for Civasola and Verdesina stream, respectively, with the difference being not statistically significant (χ-squared = 2.26, df = 1, p = 0.13). Preliminary morphological analysis based on AL/RL ratio (mean: 0.31 and SD: 0.06, N = 92) assigned the individuals to the A. italicus clade. The. AL/RL ratio values were also analysed individually for streams and sex and differences were not statistically significant in either case (p > 0.10, Fig. 2).

As for the cephalothorax length (CL), males were significantly bigger than females in both streams, but both sexes were bigger in Civasola than in Verdesina (p < 0.05 for “sex” factor, p < 0.001 for “stream” factor, see Fig. 3). In the Civasola, CL ranged between 29 and 61 mm in males (N = 20, mean: 46.3 mm and SD: 9.8 mm) and between 32 and 54 mm in females (N = 25; mean: 42.0 mm and SD: 5.3 mm), while in the Verdesina between 26 and 56 mm in males (N = 22; mean: 38.3 mm and SD: 7.1 mm) and between 22 and 44 mm in females (N = 16; mean: 33.5 mm and SD: 6.8 mm). Only 3.1% of our records showed a CL < 25 mm.

Only one COI mtDNA haplotype (H31) was found in the Civasola and Verdesina streams. Overall, the alignment included 63 haplotypes (outgroup included) with 97 variable sites: among these, 71 were parsimoniously informative. The 121 mtDNA aligned sequences showed G-biased (21.5%) nucleotide composition, high Ti/Tv ratio (34.4), did not contain any internal stop codon/indels, and they conformed to the neutral model of evolution (Tajima's D = -0.254, p > 0.05). Phylogenetic reconstructions marked out the occurrence of three clades: the first included A. i. meridionalis (PP = 1.0), the second A. i. carsicus (PP = 0.63), and the third A. i. italicus with A. i. carinthiacus (PP = 1.0). Lunigiana haplotype H31 was assigned to A. i. carinthiacus subspecies (PP = 1.0) and it was shared with 11 representatives from the northern slope of the Apennines (Fig. 4, Supplementary Table S1).

thumbnail Fig. 2

Boxplot of the ratio between the length of rostrum tip (apex length, AL) and the total rostrum length (RL), calculated according to sex and stream (males in light blue, females in red) with median, interquartile range and minimum/maximum values of the parameter.
thumbnail Fig. 3

Boxplot of cephalothorax lengths (mm) calculated according to sex and stream (males in light blue, females in red), with median, interquartile range and minimum/maximum values of the parameter.
thumbnail Fig. 4

Bayesian (BI) tree computed on crayfish individuals using 62 COI haplotypes (H, 534 bp-long sequence alignment) and A. pallipes NC026560 as outgroup (Supplementary Table 1). The statistic support was reported at each node. Lunigiana samples (N = 6) are identified by haplotype H31.

3.2 Branchiobdellidan worms

Branchiobdellidan worms (Annelida, Clitellata) were genetically identified as Branchiobdella italica Canegallo, 1929 (mtDNA COI genotyping: Boschetti et al., in prep.). The occurrence of branchiobdellidans was highly significantly different between streams (N = 85, d.f. = 1, p < 0.001;); indeed, in the Civasola stream, branchiobdellidans were not found. In the Verdesina stream, 81.9% of manipulated crayfish (N = 44: 90.9% of males and 75.0% females) hosted branchiobdellidans. Crayfish CL positively correlated with density of branchiobdellidans (N = 38, Spearman rs= 0.81, d.f. = 2, p < 0.001). This difference was highly statistically significant for both high vs. low and high vs. medium level of worm density (N = 38, d.f. = 2, p < 0.001), and statistically significant for medium vs. low level (N = 38, d.f. = 2, p < 0.01). When the difference in the prevalence of branchiobdellidans in males and females was tested, the outcome was not statistically significant (N=30, d.f. = 1, p > 0.05).

4 Discussion

The occurrence of A. italicus carinthiacus in the mountainous part of the right slope of the Magra River Basin was confirmed; nonetheless, the species appears to be uncommon and the studied populations could be relevant for the conservation of the species in the area.

4.1 Species occurrence and distribution

Literature records reporting on wildlife occurrence and distribution in Lunigiana is scant. This made the selection of streams for crayfish investigation a hard task. Civasola and Verdesina are located close to the SAC IT4020020, where A. italicus had been previously reported (Barbarotti et al., 2012). In both streams, the most individuals were found outside the main water flow, i.e. in pools located near the banks or waterfalls where the speed of the current is quite low. Almost all sampled crayfish hold cephalothorax length proper to adult individuals (Scalici and Gibertini, 2011; Ghia et al., 2015; Wendler et al., 2015; see also below). However, this result might not reflect a real disequilibrium in the distribution of the age classes. Indeed, visual search by transects more easily detect adults rather than young individuals, with the hatchlings being usually underestimated (Peay, 2003; Wendler et al., 2015). Hence, the prevailing occurrence of adults might have suffered from a bias in the methods and did not come as a surprise.

4.2 Subspecies identification

In recent years, several authors investigated distribution, phylogenetic relationships and taxonomical placement of A. italicus in Italy and Europe. Our study area was almost uninvestigated. However, data from nearby regions (Liguria, Emilia-Romagna, Tuscany itself) suggested the potential occurrence of either A. i. italicus or A. i. carinthiacus, with A. i. meridionalis, A. i. carsicus and A. pallipes representing a much rarer eventuality (Fratini et al., 2005; Cataudella et al., 2006; Bertocchi et al., 2008a; Cataudella et al., 2010; Chiesa et al., 2011). In this study, the AL/RL ratio assigned both crayfish populations to A. italicus, since its value was much closer to the ones known for this species, than to the ones reported for A. pallipes. Indeed, Laurent and Suscillon (1962) and Grandjean et al. (1998) reported an AL/RL ratio value of respectively 0.32 and 0.29 for A. italicus and 0.20 and 0.22 for A. pallipes, those values being confirmed by Chucholl et al. (2015).

Due to the high morphological variability occurring at the intraspecific level (Ghia et al., 2006; Bertocchi et al., 2008a), a DNA barcoding was also carried out to achieve a more reliable taxonomic identification. As shown in Figure 4 and Supplementary Table 1, we proved that both crayfish populations were assigned to the taxon A. i. carinthiacus, thus expanding the available distribution range of this subspecies in central Italy. The unique haplotype found in Lunigiana was shared by individuals from Lombardia (8), Emilia-Romagna (2) and Tuscany (1) (Fig. 4). Nevertheless, it is worth recalling that several authors (Machino, 1997; Holdich, 2002; Cataudella et al., 2006; Jelic et al., 2016) suggested that A. i. italicus and A. i. carinthiacus should be included in the same subspecies because of their limited genetic and morphological divergence; our reconstruction, which assigned A. i. carinthiacus to the A. i. italicus clade (Fig. 4), is in perfect agreement with these authors.

4.3 Sex ratio and sexual maturity

The sex ratio of both populations was unbalanced, even though the values did not significantly differ between the Civasola and Verdesina streams. Several studies reported a balanced sex ratio for A. pallipes species complex populations (Nowicki et al., 2008; Brusconi et al., 2008; Wendler et al., 2015). Nevertheless, some cases of biased sex ratio in healthy Austropotamobius populations are also known (Grandjean et al., 2000b; Scalici and Gibertini, 2005), up even to a males:females sex ratio of 1:1.9 (Grandjean et al., 2000b). Therefore, our data might either fall within the limits of the demographic variability of the species or depend on the limited sample size available for our populations.

Although in the Austropotamobius genus a significant differentiation among populations from different localities is known to occur, a 25 mm-long cephalothorax usually represents the minimum size in sexually mature white-clawed crayfish (Scalici and Gibertini, 2011; Ghia et al., 2015; Wendler et al., 2015, Dakic and Maguire, 2016; Maguire et al., 2017), with females usually reaching sexual maturity at a smaller size than males (Grandjean et al., 1997). Therefore, we considered all our sampled individuals as sexually mature. Sexual dimorphism and sex-specific growth pattern are known to occur in the Austropotamobius genus (Bertocchi et al., 2008a; Scalici and Gibertini, 2009; Scalici et al., 2010b; Vlach and Valdmanová, 2015). We confirmed that males usually have longer cephalothorax than females (Vlach and Valdmanová, 2015; Wendler et al., 2015).

4.4 Morphometry and ectosymbionts

For both sexes, the Civasola crayfish showed, on average, longer cephalothorax than the Verdesina ones. For instance, the longest individual (male, Civasola) showed a 61 mm-long cephalothorax, a value much higher than those reported in the literature for A. italicus and strictly related species (Matthews and Reynolds, 1995; Streissl and Hödl, 2002; Scalici et al., 2010b; Scalici and Gibertini, 2011; Caprioli et al., 2014; Vlach and Valdmanová, 2015). It could be hypothesized that such difference in cephalothorax length might be related to environmental factors (e.g., difference in food availability of Civasola and Verdesina streams) or to the age structure of the two populations (e.g., younger crayfish have a smaller CL). Nevertheless, the occurrence of Branchiobdellida in only one of the two streams deserves some attention. Branchiobdellidans are obligate ectosymbionts of crayfish and, depending on different environmental conditions, they can act as commensals, mutualists or parasites (Scalici et al., 2010a; Brown et al., 2012; DeWitt et al., 2013; Skelton et al., 2013; Vedia et al., 2014; Skelton et al., 2016; Vedia et al., 2016). Some species of branchiobdellidans can positively influence their hosts' body size and mass (Keller, 1992; Brown et al., 2002; DeWitt et al., 2013; Vedia et al., 2016). On the contrary, other species, when occurring at high density, can show parasite habits by consuming host tissues and thus affecting crayfish growth (Scalici et al., 2010a; Brown et al., 2012; Skelton et al., 2013; Skelton et al., 2016). On average, branchiobdellidan worms occurred at high density on Verdesina crayfish, which showed smaller CL values when compared to those from the Civasola stream. Although we cannot rule out other hypotheses, such as those above mentioned, we tentatively suggest that B. italica could act as parasite on A. italicus, with the abundance of branchiobdellidans either directly affecting host growth (Scalici et al., 2010a; Brown et al., 2012; Skelton et al., 2013; Skelton et al., 2016) or indirectly decreasing the fitness of the largest individuals.

Branchiobdellidan worms tend to occur more frequently on large crayfish: on the one hand, an increase in size can allow for a higher colonization of epizoic organisms; on the other hand, large crayfish moult less often than small ones (Brown et al., 2002; Brown et al., 2012; DeWitt et al., 2013; Vedia et al., 2016). Accordingly, we found, on average, that individuals with a longer cephalothorax were more heavily parasitized than those with a shorter one. As previous studies have shown (Vedia et al., 2016), the prevalence of branchiobdellidans between sexes did not significantly differ, when analysing individuals of comparable size (CL ranging between 25.0 and 45.0 mm), thus confirming that the sex factor per se does probably not influence branchiobdellidan occurrence.

4.5 Local conservation issues

In Tuscany, mountainous or hilly streams are particularly valuable for the conservation of A. italicus, as they can act as “ark sites” (Holdich et al., 2004; Souty-Grosset and Reynolds, 2009; Nightingale et al., 2017; Rosewarne et al., 2017) in the light of the occurrence of the invasive Procambarus clarkii Ortmann, 1905 (red swamp crayfish). Red swamp crayfish have largely contributed to the decline of A. italicus in central Italy through habitat competition and pathogen transmission (Legalle et al., 2008), since P. clarkii introduction in Tuscany in the ‘90s (Barbaresi and Gherardi, 2000). The distribution range of this invasive exotic species seems limited by elevation (Gil-Sànchez and Alba-Tercedor, 2002); therefore, high altitude streams could be fundamental for the survival of autochthonous A. italicus in the upper part of watercourses colonized by P. clarkii.

The two streams identified in the present study harbour viable populations of A. italicus and meet the main criteria for the definition of ark sites. Thus, we suggest that the Civasola and Verdesina streams could be considered as “natural ark sites” for the conservation of the species in Tuscany and deserve an adequate protection level.

RoR plants, although less impacting than traditional ones, cannot prevent habitat stresses for aquatic invertebrates and may have cumulative effects when multiple RoR projects exist on the same river basin (Douglas, 2007; Kern et al., 2012; Lazzaro et al., 2013; Gibeau et al., 2016). Thus, a proper and updated knowledge of local torrential fauna is mandatory to consider the occurrence of protected species (Douglas, 2007) and to allow a careful evaluation of a potentially detrimental use of the territory.

5 Conclusions

The insufficient knowledge of the local biodiversity heritage can lead to a lack of proper conservation and management actions or even to harmful over- exploitation. We have contributed to the update of A. italicus distribution and to the knowledge of morphological and genetic characteristics of central Italy populations, and we have gained an insight into a potential parasitic role of B. italica on A. italicus that deserves future investigation. Further studies will be required in order to develop proper conservation plans for A. italicus in the Lunigiana region.

Supplementary Material

Supplementary Table S1. Access here

Acknowledgments

We sincerely thank Marco A. L. Zuffi (Museum of Natural History, University of Pisa), Barbara Giovannini, Linda Pierattini and Loretta Dini for their support in the fieldwork; Fabrizio Erra (Department of Biology, University of Pisa), for his advice on statistical analyses; Camping “La Cascina di Baruccia” (Grondola, Pontremoli) reception staff for field-team accommodation; Riccardo Moggi and Monica Giannecchini (Kigelia ONLUS Association) for their support and interest in our research; Gianna Innocenti (Museum of Natural History “La Specola”, University of Florence) for sharing information on Lunigiana streams; the MONITO-RARE Project of Regione Toscana for supporting the drafting phase of this article and future continuations of the study. We wish to dedicate this study to Pier Carlo Pinotti, who allowed us to discover the valuable environment of the Verdesina stream.

References

  • Amouret J, Bertocchi S, Brusconi S, Fondi M., Gherardi F, Grandjean F, Souty-Grosset C. 2015. The first record of translocated white-clawed crayfish from the Austropotamobius pallipes complex in Sardinia (Italy). J Limnol 74: 491–500. [Google Scholar]
  • Aquiloni L, Tricarico E, Gherardi F. 2010. Crayfish in Italy: distribution, threats and management. Int Aquat Res 2: 1–14. [Google Scholar]
  • Autorità Bacino Magra, 2000. Tutela dei corsi d'acqua interessati dalle derivazioni (Relazione generale e Norme di attuazione). Sarzana − La Spezia. Available on: www.adbmagra.it. [Google Scholar]
  • Autorità di Bacino del Fiume Arno, 2017a. Distretto Idrografico dell'Appennino Settentrionale: Piano di Gestione delle Acque − Scheda Corpo idrico Torrente Civasola-Fosso Dei Grumi. Elenco corpi idrici per Regione −Regione: TOSCANA − Categoria:Fiumi. http://www.appenninosettentrionale.it/eis/scheda_corpo_idrico_gen.php?log=&cod=IT09CI_I018MA467fi&tipocod=wise&direttiva=2000&lingua=ITA . (November 30, 2017). [Google Scholar]
  • Autorità di Bacino del Fiume Arno, 2017b. Distretto Idrografico dell'Appennino Settentrionale: Piano di Gestione delle Acque − Scheda Corpo idrico Torrente Verdesina-Fosso Del Farneto. Elenco corpi idrici per Regione −Regione: TOSCANA − Categoria:Fiumi. http://www.appenninosettentrionale.it/eis/scheda_corpo_idrico_gen.php?log=&cod=IT09CI_I018MA764fi&tipocod=wise&direttiva=2000&lingua=ITA. (November 30, 2017). [Google Scholar]
  • Baillie J, Groombridge B. 1996. Red List of Threatened Animals. IUNC: Gland, Switzerland. [Google Scholar]
  • Barbaresi S, Gherardi F. 2000. The invasion of the alien crayfish Procambarus clarkii in Europe, with particular reference to Italy. Biol Invasions 2: 259–264. [CrossRef] [Google Scholar]
  • Barbarotti S, Zanzucchi S, Gandolfi G. 2012. Rete Natura 2000-SIC − ZPS It4020020 Crinale Dell'appennino Parmense − Redazione delle misure specifiche di conservazione e dei piani di gestione dei Siti Rete Natura 2000. Available at: http://www.parcoappennino.it/pdf/IT4020020.Relazione.pdf. [Google Scholar]
  • Beaune D, Sellier Y, Luquet G, Grandjean F. 2018. Freshwater acidification: an example of an endangered crayfish species sensitive to pH. Hydrobiologia, 1–10. [Google Scholar]
  • Bernini G, Bellati A, Pellegrino I, Negri A, Ghia D, Fea G, Galeotti P. 2016. Complexity of biogeographic pattern in the endangered crayfish Austropotamobius italicus in northern Italy: molecular insights of conservation concern. Conserv Genet 17: 141–154. [CrossRef] [Google Scholar]
  • Bertocchi S, Brusconi S, Gherardi F, Buccianti A, Scalici M. 2008a. Morphometrical characterization of the Austropotamobius pallipes species complex. J Nat Hist 42: 2063–2077. [CrossRef] [Google Scholar]
  • Bertocchi S, Brusconi S, Gherardi F, Grandjean F, Souty-Grosset C. 2008b. Genetic variability of the threatened crayfish Austropotamobius italicus in Tuscany (Italy): Implications for its management. Fundam Appl Limnol 173: 153–164. [CrossRef] [Google Scholar]
  • Bologna M, Rovelli V, Zapparoli M. 2016. Invertebrates. In: Stoch F, Genovesi P (eds.), Handbooks for monitoring species and habitats of Community interest (Council Directive 92/43/EEC) in Italy: animal species. ISPRA, Series Handbooks and Guidelines, 141/2016. [Google Scholar]
  • Brown BL, Creed RP, Dobson WE. 2002. Branchiobdellid annelids and their crayfish hosts: are they engaged on a cleaning symbiosis? Oecol 132: 250–255. [CrossRef] [PubMed] [Google Scholar]
  • Brown BL, Creed RP, Skelton J, Rollins MA, Farrell KJ. 2012. The fine line between mutualism and parasitism: complex effects in a cleaning symbiosis demonstrated by multiple field experiments. Oecol 170: 199–207. [CrossRef] [PubMed] [Google Scholar]
  • Brusconi S, Bertocchi S, Renai B, Scalici M, Souty‐Grosset C, Gherardi F. 2008. Conserving indigenous crayfish: stock assessment and habitat requirements in the threatened Austropotamobius italicus. Aquat Conserv 18: 1227–1239. [CrossRef] [Google Scholar]
  • Buffagni A, Erba S. 2007. Macroinvertebrati acquatici e Direttiva 2000/60/EC (WFD)-Parte A. Metodo di campionamento per i fiumi guadabili. IRSA-CNR Not met ana 1: 2–27. [Google Scholar]
  • Caprioli R, Garozzo P, Giansante C, Ferri N. 2014. Reproductive performance in captivity of Austropotamobius pallipes in Abruzzi Region (central Italy). Invertebr Reprod Dev 58: 89–96. [CrossRef] [Google Scholar]
  • Cataudella R, Puillandre N, Grandjean F. 2006. Genetic analysis for conservation of Austropotamobius italicus populations in Marches region (central Italy). Bull Fr Pêche Piscic 380-381: 991–1000. [Google Scholar]
  • Cataudella R, Paolucci M, Delaunay C, Ropiquet A, Hassanin A, Balsamo M, Grandjean F. 2010. Genetic variability of Austropotamobius italicus in the Marches region: implications for conservation. Aquat Conserv 203: 261–268. [Google Scholar]
  • Chiesa S, Scalici M, Negrini R, Gibertini G, Nonnis Marzano F. 2011. Fine-scale genetic structure, phylogeny and systematics of threatened crayfish species complex. Mol Phylogenet Evol 61: 1–11. [CrossRef] [PubMed] [Google Scholar]
  • Chucholl C, Mrugała A, Petrusek A. 2015. First record of an introduced population of the southern lineage of white-clawed crayfish (Austropotamobius “italicus”) north of the Alps. Knowl Manag Aquat Ecosyst 416: 10. [CrossRef] [Google Scholar]
  • Cianfanelli S, Vanni S, Innocenti G, Nistri A, Agnelli P. 2016. Nota preliminare sulle emergenze faunistiche della Lunigiana (Toscana nord-occidentale, Italia). Ann Mus Civ Stor Nat Doria 108: 3. [Google Scholar]
  • Ciuffardi L, Mori M, Braida L, Pini D, Arillo A. 2009. I crostacei decapodi del bacino del fiume Magra (La Spezia, Italia Nord Occidentale). Ann Mus Civ Stor Nat Doria 50: 273–291. [Google Scholar]
  • Covich A, Palmer M, Crowl T. 1999. The Role of Benthic Invertebrate Species in Freshwater Ecosystems − Zoobenthic Species Influence Energy Flows and Nutrient Cycling. Bioscience 49: 119–127. [CrossRef] [Google Scholar]
  • Crandall KA, De Grave S. 2017. An updated classification of the freshwater crayfishes (Decapoda: Astacidea) of the world, with a complete species list. J Crustacean Biol 37: 615–653. [CrossRef] [Google Scholar]
  • Dakic L, Maguire I. 2016. Year cycle and morphometrical characteristics of Austropotamobius torrentium from two karstic rivers in Croatia. Nat Croat 25: 87. [CrossRef] [Google Scholar]
  • De Luise G. 2006. I crostacei decapodi d'acqua dolce in Friuli Venezia Giulia. Recenti acquisizioni sul comportamento e sulla distribuzione nelle acque dolci della Regione. Venti anni di studi e ricerche. Ente Tutela Pesca − Regione Friuli Venezia Giulia. [Google Scholar]
  • DeWitt PD, Williams BW, Lu Z-Q., Fard AN, Gelder SR. 2013. Effects of environmental and host physical characteristics on an aquatic symbiont. Limnologica 43: 151–156. [CrossRef] [Google Scholar]
  • Dini L. 2015. Analisi della fauna torrentizia della Lunigiana: elementi di interesse e criticità dell'area. Degree dissertation in Biological Sciences, University of Pisa, Italy. Available at: https://etd.adm.unipi.it/t/etd-02112016-164353/ [Google Scholar]
  • Douglas, T. 2007. “Green” Hydro Power − Understanding Impacts, Approvals, and Sustainability of Run-of-River Independent Power Projects in British Columbia. Watershed Watch Salmon Society. [Google Scholar]
  • Excoffier L, Lischer HEL. 2010. Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows. Mol Ecol Resour 10: 564–567. [Google Scholar]
  • Favilli L, Manganelli G. 2002. Il gambero di fiume italiano (Austropotamobius fulcisianus) (Crustacea, Decapoda, Astacidae) nel bacino del Farma-Merse (Toscana meridionale). Atti Soc Toscana Sci Nat Pisa Mem Ser B, 108, 43–49. [Google Scholar]
  • Fratini S, Zaccara S, Barbaresi S, Grandjean F, Souty-Grosset C, Crosa G, Gherardi F. 2005. Phylogeography of the threatened crayfish (genus Austropotamobius) in Italy: implications for its taxonomy and conservation. Heredity 94: 108–118. [CrossRef] [PubMed] [Google Scholar]
  • Frings R, Vaeßen M, Groß SC, Roger H, Schüttrumpf S, Hollert, H. 2013. A fish-passable barrier to stop the invasion of non-indigenous crayfish. Biol Cons 159: 521–529. [CrossRef] [Google Scholar]
  • Füreder L, Reynolds JD. 2003. Is Austropotamobius pallipes a good bioindicator? Bull Fr Pêche Piscic 370-371: 157–163. [Google Scholar]
  • Füreder L, Gherardi F, Holdich D, Reynolds J, Sibley P, Souty-Grosset, C. 2010. Austropotamobius pallipes. The IUCN Red List of Threatened Species 2010: e.T2430 A9438817. [Google Scholar]
  • Ghia D, Nardi PA, Negri A, Bernini F, Bonardi A, Fea G, Spairani M. 2006. Syntopy of A. pallipes and A. italicus: Genetic and Morphometrical Investigations. Bull Fr Pêche Piscic 380-381: 1001–1018. [CrossRef] [Google Scholar]
  • Ghia D, Fea G, Conti A, Sacchi R, Nardi PA. 2015. Estimating age composition in alpine native populations of Austropotamobius pallipes complex. J Limnol 74: 501–511. [Google Scholar]
  • Gibeau P, Connors BM, Palen WJ. 2016. Run-of-River hydropower and salmonids: potential effects and perspective on future research. Can J Fish Aquat Sci 999: 1–15. [Google Scholar]
  • Gil-Sànchez JM, Alba-Tercedor J. 2002. Ecology of the native and introduced crayfishes Austropotamobius pallipes and Procambarus clarkii in southern Spain and implications for conservation of the native species. Biol Cons 105: 75–80. [CrossRef] [Google Scholar]
  • Grandjean F, Romain D, Souty-Grosset C, Mocquard JP. 1997. Size at sexual maturity and morphometric variability in three populations of Austropotamobius pallipes pallipes (Lereboullet, 1858) according to a restocking strategy. Crustaceana 70: 454–468. [CrossRef] [Google Scholar]
  • Grandjean F, Gouin N, Frelon M, Souty-Grosset C. 1998. Genetic and morphological systematic studies on the crayfish Austropotamobius pallipes (Decapoda: Astacidae). J Crust Biol 18: 549–555. [CrossRef] [Google Scholar]
  • Grandjean F, Harris DJ, Souty-Grosset C, Crandall KA. 2000a. Systematics of the European endangered crayfish species Austropotamobius pallipes (Decapoda: Astacidae). J Crust Biol 20: 522–529. [CrossRef] [Google Scholar]
  • Grandjean F, Cornuault B, Archambault S, Bramard M, Otrebsky G. 2000b. Life history and population biology of the white-clawed crayfish, Austropotamobius pallipes pallipes, in a brook from the Poitou-Charentes region (France). Bull Fr Pêche Piscic 356: 55–70. [CrossRef] [Google Scholar]
  • Grandjean F, Tan MH, Gan HY, Gan HM, Austin CM. 2016. The complete mitogenome of the endangered white-clawed freshwater crayfish Austropotamobius pallipes (Lereboullet, 1858) (Crustacea: Decapoda: Astacidae). Mitochondrial DNA 27: 3329–3330. [PubMed] [Google Scholar]
  • Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. 2010. New algorithms and methods to estimate Maximum-Likelihood phylogenies: assessing the performance of PhyML 3.0. Syst Biol 59: 307–321. [Google Scholar]
  • Hasegawa M, Kishino H, Yano T. 1985. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J Mol Evol 22: 160–174. [CrossRef] [PubMed] [Google Scholar]
  • Holdich DM, Reeve ID. 1991. Distribution of freshwater crayfish in the British Isles, with particular reference to crayfish plague, alien introductions and water quality. Aquat Conserv 1: 139–158. [Google Scholar]
  • Holdich DM. 2002. Distribution of crayfish in Europe and some adjoining countries. Bull Fr Pêche Piscic 367: 611–650. [Google Scholar]
  • Holdich D, Sibley P, Peay S. 2004. The White-clawed Crayfish-a decade on. British Wildlife 15: 153–164. [Google Scholar]
  • Huelsenbeck JP, Ronquist F. 2001. MrBayes: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755. [CrossRef] [PubMed] [Google Scholar]
  • Jay D, Holdich DM. 1977. The pH tolerance of the crayfish Austropotamobius pallipes (Lereboullet). Freshw Crayfish 3: 363–370. [Google Scholar]
  • Jay D, Holdich DM. 1981. The distribution of the crayfish, Austropotamobius pallipes, in British waters. Freshw Biol 11: 121–129. [Google Scholar]
  • Jelic M, Klobucar GIV, Grandjean F, Puillandre N, Franjevic D, Futo M, Maguire I. 2016. Insights into the molecular phylogeny and historical biogeography of the white-clawed crayfish (Decapoda, Astacidae). Mol Phylogenet Evol 103: 26–40. [CrossRef] [PubMed] [Google Scholar]
  • Kaunda CS, Kimambo CZ, Nielsen TK. 2012. Hydropower in the context of sustainable energy supply: a review of technologies and challenges. ISRN Renewable Energy. [Google Scholar]
  • Keller TA. 1992. The effect of the branchiobdellid annelid Cambarincola fallax on the growth rate and condition of the crayfish Orconectes rusticus. J Freshw Ecol 7: 165–171. [CrossRef] [Google Scholar]
  • Kerby JL, Riley SP, Kats LB, Wilson P. 2005. Barriers and flow as limiting factors in the spread of an invasive crayfish (Procambarus clarkii) in southern California streams. Biol Cons 126: 402–409. [CrossRef] [Google Scholar]
  • Kern J, Characklis G, Doyle M, Blumsack S, Whisnant R. 2012. Influence of deregulated electricity markets on hydropower generation and downstream flow regime, J Water Resour Plann Manage 138: 342–355. [CrossRef] [Google Scholar]
  • Kouba A, Petrusek A, Kozák P. 2014. Continental-wide distribution of crayfish species in Europe: update and maps. Knowl Manag Aquat Ecosyst 413: 05. [CrossRef] [EDP Sciences] [Google Scholar]
  • Kumar D, Katoch SS. 2015. Sustainability suspense of small hydropower projects: A study from western Himalayan region of India. Renew Energy 76: 220–233. [CrossRef] [Google Scholar]
  • Laurent PJ, Suscillon M. 1962. Les écrevisses en France. Ann Stn cent hydrobiol appl 9: 335–395. [Google Scholar]
  • Lazzaro G, Basso S, Schirmer M, Botter G. 2013. Water management strategies for run-of-river power plants: Profitability and hydrologic impact between the intake and the outflow. Water Resour Res 49: 8285–8298. [CrossRef] [Google Scholar]
  • Lefort V, Longueville JE, Gascuel O. 2017. SMS: Smart Model Selection in PhyML. Mol Biol Evol. DOI:10.1093/molbev/msx149. [Google Scholar]
  • Legalle M, Mastrorillo S, Céréghino R. 2008. Spatial distribution patterns and causes of decline of three freshwater species with different biological traits (white-clawed crayfish, bullhead, freshwater pearl mussel): a review. Ann Limnol - Int J Lim 44: 95–104. [CrossRef] [Google Scholar]
  • Machino Y. 1997. New white-clawed crayfish Austropotamobius pallipes (Lereboullet, 1858) occurrences in Carinthia, Austria. Bull Fr Pêche Piscic 347: 713–720. [CrossRef] [Google Scholar]
  • Maguire I, Marn N, Klobučar G. 2017. Morphological evidence for hidden diversity in the threatened stone crayfish Austropotamobius torrentium (Schrank, 1803) (Decapoda: Astacoidea: Astacidae) in Croatia. J Crust Biol 37: 7–15. [Google Scholar]
  • Manenti R, Bonelli M, Scaccini D, Binda A, Zugnoni A. 2014. Austropotamobius pallipes reduction vs. Procambarus clarkii spreading: management implications. J Nat Conserv 22: 586–591. [CrossRef] [Google Scholar]
  • Manganelli G, Favilli L, Fiorentino V. 2006. Taxonomy and nomenclature of Italian white-clawed crayfish. Crustaceana 79: 633–640. [CrossRef] [Google Scholar]
  • Matthews MA, Reynolds JD. 1995. A population study of the white clawed crayfish Austropotamobius pallipes (Lereboullet) in an Irish reservoir. Biol Environ 95: 99–109. [Google Scholar]
  • Morpurgo M, Aquiloni L, Bertocchi S, Brusconi S, Tricarico E, Gherardi F, Romana V. 2010. Distribuzione dei gamberi d'acqua dolce in Italia. Studi Trent Sci Nat 87: 125-132, 87, 125–132. [Google Scholar]
  • Nightingale J, Stebbing P, Sibley P, Brown O, Rushbrook B, Jones G. 2017. A review of the use of ark sites and associated conservation measures to secure the long-term survival of White-clawed crayfish Austropotamobius pallipes in the United Kingdom and Ireland. Int Zoo Yearb 51: 50–68. [CrossRef] [Google Scholar]
  • Nowicki P, Tirelli T, Sartor RM, Bona F, Pessani D. 2008. Monitoring crayfish using a mark-recapture method: potentials, recommendations, and limitations. Biodivers Conserv 17: 3513–3530. [CrossRef] [Google Scholar]
  • Paish O. 2002. Small hydro power: technology and current status. Renew Sustain Energy Rev 6: 537–556. [CrossRef] [Google Scholar]
  • Pârvulescu L, Zaharia C. 2013. Current limitations of the stone crayfish distribution in Romania: implications for its conservation status. Limnologica 43: 143–150. [CrossRef] [Google Scholar]
  • Pârvulescu L, Pacioglu O, Hamchevici C. 2011. The assessment of the habitat and water quality requirements of the stone crayfish (Austropotamobius torrentium) and noble crayfish (Astacus astacus) species in the rivers from the Anina Mountains (SW Romania). Knowl Manag Aquat Ecosyst 03: 401–03. [Google Scholar]
  • Peay S., 2003. Monitoring of the White-clawed crayfish, Austropotamobius pallipes. Conserving Natura 2000. Rivers Monitoring Series No. 1, English Nature, Peterborough, 52 p. [Google Scholar]
  • Pratten DJ. 1980. Growth in the crayfish Austropotamobius pallipes (Crustacea: Astacidae). Freshw Biol 10: 401–402. [CrossRef] [Google Scholar]
  • . Quantum GIS Development Team. 2009. Quantum GIS Geographic Information System. Open Source Geospatial Foundation Project. http://grass.osgeo.org. [Google Scholar]
  • Rambaud A, Drummond AJ. 2007. Tracer 1.5, Available from http://beast.bio.ed.ac.uk/Tracer. [Google Scholar]
  • Reynolds JD, Demers A, Marnell F. 2002. Managing an abundant crayfish resource for conservation − A. pallipes in Ireland. Bull Fr Pêche Piscic 367: 823–832. [CrossRef] [Google Scholar]
  • Rosewarne PJ, Mortimer RJG, Dunn AM. 2017. Habitat use by the endangered white-clawed crayfish Austropotamobius species complex: a systematic review. Knowl Manag Aquat Ecosyst 418: 4. [CrossRef] [Google Scholar]
  • RStudio Team. 2015. RStudio: Integrated Development for R. RStudio, Inc., Boston, MA. http://www.rstudio.com/. [Google Scholar]
  • Scalici M, Gibertini G. 2005. Can Austropotamobius italicus meridionalis be used as a monitoring instument in cental Italy? Bull Fr Pêche Piscic 376: 613–625. [Google Scholar]
  • Scalici M, Gibertini G. 2009. Sexual dimorphism and ontogenetic variation in the carapace of A. pallipes (Lereboullet, 1858). Ital J Zool 76: 179–188. [CrossRef] [Google Scholar]
  • Scalici M, Gibertini G. 2011. Reproduction in the threatened crayfish Austropotamobius pallipes (Decapoda, Astacidae) in the Licenza brook basin (central Italy). Ital J Zool 78: 198–208. [CrossRef] [Google Scholar]
  • Scalici M, Di Giulio A, Gibertini G. 2010a. Biological and morphological aspects of Branchiobdella italica (Annelida: Clitellata) in a native crayfish population of central Italy. Ital J Zool 77: 410–418. [CrossRef] [Google Scholar]
  • Scalici M, Macale D, Gibertini G. 2010b. Allometry in the ontogenesis of Austropotamobius pallipes species complex (Decapoda: Astacidae): The use of geometric morphometrics. Ital J Zool 77: 296–302. [CrossRef] [Google Scholar]
  • Skelton J, Farrell KJ, Creed RP, Williams BW, Ames C, Helms BS, Brown BL. 2013. Servants, scoundrels, and hitchhikers: current understanding of the complex interactions between crayfish and their ectosymbiotic worms (Branchiobdellida). Freshw Sci 32: 1345–1357. [CrossRef] [Google Scholar]
  • Skelton J, Doak S, Leonard M, Creed RP, Brown BL. 2016. The rules for symbiont community assembly change along a mutualism-parasitism continuum. J Anim Ecol 85: 843–853. [CrossRef] [PubMed] [Google Scholar]
  • Souty-Grosset C, Reynolds JD. 2009. Current ideas on methodological approaches in European crayfish conservation and restocking procedures. Knowl Manag Aquat Ecosyst 394-395: 1. [Google Scholar]
  • Stoch F, Vigna Taglianti A. 2014. Fauna: Invertebrati. In: Genovesi P, Angelini P, Bianchi E, Dupré E, Ercole S, Giacanelli V, Ronchi F, Stoch F., ed. Specie e habitat di interesse comunitario in Italia: distribuzione, stato di conservazione e trend. ISPRA, Serie Rapporti, 194/2014. [Google Scholar]
  • Streissl F, Hödl W. 2002. Growth, morphometrics, size at maturity, sexual dimorphism and condition index of Austropotamobius torrentium Schrank. Hydrobiologia 477: 201–208. [CrossRef] [Google Scholar]
  • Svobodová J, Douda K, Štambergová M, Picek J, Vlach P, Fischer D. 2012. The relationship between water quality and indigenous and alien crayfish distribution in the Czech Republic: Patterns and conservation implications. Aquat Conserv 22: 776–786. [CrossRef] [Google Scholar]
  • Tajima F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123: 585–595. [PubMed] [Google Scholar]
  • Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 4876–4882. [Google Scholar]
  • Trontelj P, MacHino Y, Sket B. 2005. Phylogenetic and phylogeographic relationships in the crayfish genus Austropotamobius inferred from mitochondrial COI gene sequences. Mol Phylogenet Evol 34: 212–226. [CrossRef] [PubMed] [Google Scholar]
  • Trouilhé MC, Souty-Grosset C, Grandjean F, Parinet B. 2007. Physical and chemical water requirements of the white-clawed crayfish (Austropotamobius pallipes) in western France. Aquat Conserv 17: 520–538. [Google Scholar]
  • Vedia I, Oscoz J, Rueda J, Miranda R, García-Roger EM, Baquero E, Gelder SR. 2014. An alien ectosymbiotic branchiobdellidan (Annelida: Clitellata) adopting exotic crayfish: a biological co-invasion with unpredictable consequences. Inland Waters 5: 89–92. [CrossRef] [Google Scholar]
  • Vedia I, Oscoz J, Baquero E. 2016. Invading the invaders: relationships of an exotic branchiobdellidan with its exotic host and environmental conditions. Inland Waters 6: 54–64. [CrossRef] [Google Scholar]
  • Vlach P, Valdmanová L. 2015. Morphometry of the stone crayfish (Austropotamobius torrentium) in the Czech Republic: allometry and sexual dimorphism. Knowl Manag Aquat Ecosyst 416: 16. [Google Scholar]
  • Vlach P, Svobodová J, Fischer D. 2012. Stone crayfish in the Czech Republic: how does its population density depend on basic chemical and physical properties of water? Knowl Manag Aquat Ecosyst 407: 5. [CrossRef] [Google Scholar]
  • Wendler F, Biss R, Chucholl C. 2015. Population ecology of endangered white-clawed crayfish (Austropotamobius pallipes s. str .) in a small rhithral river in Germany. Knowl Manag Aquat Ecosyst 416: 1–16. [Google Scholar]
  • Zaccara S, Stefani F, Crosa G. 2005. Diversity of mitochondrial DNA of the endangered white-clawed crayfish (Austropotamobius italicus) in the Po River catchment. Freshw Biol 50: 1262–1272. [CrossRef] [Google Scholar]

Cite this article as: Boschetti M, Culicchi A, Guerrini M, Barbanera F, Petroni G. 2018. Preliminary data on the distribution, morphology and genetics of white-clawed crayfish and on their ectosymbionts in Lunigiana (Tuscany, Italy). Knowl. Manag. Aquat. Ecosyst., 419, 25.

All Tables

Table 1

Streams investigated in the present study, with municipality/locality, altitude on sea level of the starting point of each transect (Alt) and environmental features of the streams. Av height = average water height in the transect, during the sampling occasions. Av width = average width of the streambed within the transect. Av substratum = prevailing substratum in the riverbed, classified as megalithal (rocks and stones of >40 cm in diameter), macrolithal (stones between 20 and 40 cm in diameter), mesolithal (stones between 6 and 20 cm in diameter) and microlithal (small stones between 2 and 6 cm in diameter) (Buffagni and Erba, 2007). Riparian vegetation = presence of vegetation (trees and bushes) both autocthonous and allocthonous, along the banks of the stream. Streams hosting crayfish are highlighted in bold.

In the text

All Figures

thumbnail Fig. 1

Geographic context and map of the study area (Lunigiana, Tuscany, Italy). Nine transects were performed in eight streams. Red stars mark out the streams where we recorded white-clawed crayfish populations, while orange dots mark out surveyed streams where crayfish were not found. Modified from QGIS 2.14 open-source software (Quantum GIS Development Team, 2009).
In the text
thumbnail Fig. 2

Boxplot of the ratio between the length of rostrum tip (apex length, AL) and the total rostrum length (RL), calculated according to sex and stream (males in light blue, females in red) with median, interquartile range and minimum/maximum values of the parameter.
In the text
thumbnail Fig. 3

Boxplot of cephalothorax lengths (mm) calculated according to sex and stream (males in light blue, females in red), with median, interquartile range and minimum/maximum values of the parameter.
In the text
thumbnail Fig. 4

Bayesian (BI) tree computed on crayfish individuals using 62 COI haplotypes (H, 534 bp-long sequence alignment) and A. pallipes NC026560 as outgroup (Supplementary Table 1). The statistic support was reported at each node. Lunigiana samples (N = 6) are identified by haplotype H31.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.