Open Access
Table 1
Specific ddPCR primers (F and R) and probe (P) used for Anguilla anguilla and Silurus glanis detection. Probes are 5′-end modified with a fluorescent dye, and equipped with a quencher-modification at the 3′-end. Names, sequences (5'-> 3') and target fragment length (bp) are indicated.
| Target species | Primer and probe name | Sequence (5' −> 3') | Lenght (bp) |
|---|---|---|---|
| Anguilla anguilla | Angang_F10571 | ATCTAGCAACGGACCCCTTA | 106 |
| Angang_R10676b | TTGGTTGGTTCTAGCCGCA | ||
| Angang_P10595 | FAM-ACACCACTACTAGTTTTATCTTGCT-BHQ1 | ||
| Silurus glanis | 284F | GACTTCTCCCTCCTTCATTCCTG | 117 |
| 400R | AAGCACCTGCGTGGGCG | ||
| Pr324F | HEX-CGGAGTCGAAGCGGGC-BHQ2 |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
