Table 2
DNA primer pairs used for PCR. Modified primer sequences (ZF2 and HC) are indicated, with variations in degenerated bases marked in bold. Primer pairs were designed for amplifying specific regions, including mt COI (mitochondrial cytochrome c oxidase I gene), 12S mt RNA (mitochondrial 12S RNA gene), and cp tnrL intron (P6 loop of the tnrL intron chloroplast DNA), Annealing temperature (°C) is also provided. n.a. : not applicable.
| Primer name | Target taxa | Target gene | Primer version | Primer type | Primer sequence (5'-3') | Annealing temperature | Reference |
|---|---|---|---|---|---|---|---|
| MiBird-U-F | Birds | mt 12S rRNA | Original | Forward | GGGTTGGTAAATCTTGTGCCAGC | 50 °C | Ushio et al. (2018) |
| MiBird-U-R | Birds | mt 12S rRNA | Original | Reverse | CATAGTGGGGTATCTAATCCCAGTTTG | 50 °C | Ushio et al. (2018) |
| ZBJ-ArtF1C | Arthropods | mt COI | Original | Forward | AGATATTGGAACWTTATATTTTATTTTTGG | n.a. | Zeale et al. (2011) |
| HCO1777 | Invertebrates | mt COI | Original | Reverse | ACTTATATTGTTTATACGAGGGAA | n.a. | Brown et al. (2012); Verkuil et al. (2022) |
| ZF2 | Invertebrates | mt COI | Modified from ZBJ-ArtF1C | Forward | GATATTGGWACHTTWTAYTTTHTHTTYGG | 48 °C | this study |
| HC | Invertebrates | mt COI | Modified from HCO1777 | Reverse | ACTTATATTRTTTATACGAGGGAA | 48 °C | this study |
| trnL_g | Plants | cp tnrL intron | Original | Forward | GGGCAATCCTGAGCCAA | 53 °C | Taberlet et al. (2007) |
| trnL_h | Plants | cp tnrL intron | Original | Reverse | CCATTGAGTCTCTGCACCTATC | 53 °C | Taberlet et al. (2007) |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
