Table 1
Primers and thermal cycling profiles used for DNA barcoding of H. invalida.
| Gene | Primer name | Primer sequence 5'-3' | PCR thermal condition | References |
|---|---|---|---|---|
| COI | LCO1490 | GGTCAACAAATCATAAAGATATTGG | 1 cycle of 95 °C for 180 s (initial denaturation); 35 cycles each of 95 °C for 30 s, 45 °C for 30 s and 72 °C for 45 s; with a final 72 °C extension for 120 s | Folmer et al. (1994) |
| HCO2198 | TAAACTTCAGGGTGACCAAAAAATCA | |||
| 18S rRNA | Hyp18s_54F | AACGGCTCATTAGATCAGTTGATA | 1 cycle of 95 °C for 260 s (initial denaturation); 35 cycles each of 95 °C for 40 s, 50 °C for 30 s, 72 °C for 55 s;with a final 72 °C extension for 120 s | This study |
| Hyp18s_1135R | GCAGTAGTCGTAAAGACTGACG | |||
| Hyp18s_833F | AACGACCGCCTGAATAATGTTGC | |||
| Hyp18s_1951R | GGGTAAGATCCGTGGTTCTTGCT |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.